journal_list | How to participate | E-utilities
Shim, Seo, and Lee: Antimicrobial resistance and virulence genes of β-lactamase producing E. coli isolated from commercial layers

Abstract

Many β-lactam antimicrobials, including cephalosporins, have been used in both veterinary and human medicine in the treatment of zoonotic and infectious diseases. Especially, third-generation cephalosporins such as ceftiofur have been approved for systemic use in food-producing animals, which has resulted in the emergence of β-lactamase genes. This study aimed to investigate the occurrence of β-lactamase-producing E. coli isolated from commercial layers and characterized their antimicrobial resistance and virulence genes. Among the 85 cefotaxime (CTX)-resistant E. coli, all isolates showed resistance to at least one antimicrobial, and the rates of resistance to nalidixic acid, cephalothin, ampicillin, and cefazolin were more than 50.0%. In particular, 28 isolates were identified as containing b-lactamase genes. The extended-spectrum β-lactamase (ESBL) and plasmid-mediated AmpC genes blaCTX-M-1, blaCTX-M-14, blaCTX-M-15, and blaCMY-2 were detected in 1, 6, 5, and 4 isolates, respectively. The non-ESBL/pAmpC gene blaTEM-1 was detected in 12 isolates. The distribution of antimicrobial resistance genes in 28 β-lactamase-producing E. coli was as follows: aac(3)-II (64.3%), sul2 (32.1%), tetA (28.6%), sul1 (25.0%), cmlA gene (25.0%), and tetB (14.3%). In total, 6 virulence genes (astA, eaeA, escV, fimH, iucC, and papC) were also identified and the rates in virulence gene were as below: fimH (92.9%), iucC (25.0%), astA (21.4%), papC (10.7%), eaeA (7.1%) and escV (7.1%). Our findings suggest that antimicrobials used in commercial layer must be regulated in Korea, and comprehensive surveillance is necessary to prevent the dissemination of resistant isolates.

Antimicrobials are integral to current medicine, both veterinary and human, in the treatment of zoonotic and infectious diseases. Since the discovery of penicillin by Fleming in 1929, many β-lactam antimicrobials, including cephalosporins, have been developed to effectively control most bacterial infections [10, 32]. Especially, third-generation cephalosporins such as ceftiofur have been approved for systemic use in food-producing animals in many countries [14]. After the application of such antimicrobials, dissemination of β-lactamase genes has increase and caused considerable problem [2]. The emergence of β-lactamase-producing E. coli from layer is a public health problem because it can spread through the food chain from eggs to the humans [5]. Recently, various antimicrobial resistance and virulence genes have been detected in E. coli [17, 22], but little is known about the β-lactamase-producing E. coli isolates from commercial layers. This study aimed to investigate the occurrence of β-lactamase-producing E. coli isolated from commercial layers and to characterize their antimicrobial resistance and virulence genes.
During the period from 2017 to 2018, 85 E. coli isolates demonstrating cefotaxime (CTX) resistance were selected from 21 commercial layer farms. Using the diffusion test, all CTX-resistant E. coli isolates were investigated for antimicrobial resistance using amoxicillin–clavulanate (20/10 mg), ampicillin (10 mg), cefadroxil (30 mg), cefazolin (30 mg), cefepime (30 mg), cefoxitin (30 mg), cefuroxime (30 mg), cephalothin (30 mg), chloramphenicol (30 mg), ciprofloxacin (5 mg), gentamicin (10 mg), imipenem (10 mg), nalidixic acid (30 mg), tetracycline (30 mg), and trimethoprim–sulfamethoxazole (1.25/23.75 mg) discs (BD Biosciences, Sparks, MD, USA) in accordance with the Clinical and Laboratory Standards Institute guidelines [6]. Antimicrobial resistant genes were detected by PCR amplification with specific primers as summarized in Table 1. Assessment of the b-lactamase genes blaCTX-M [25], blaTEM [3], blaSHV [3], blaOXA [3] and plasmid-mediated AmpC (pAmpC) [24] was performed in all CTX-resistant E. coli isolates. To detect other antimicrobial resistance genes in β-lactamase-producing E. coli, the following genes were also tested: tetracycline (tetA and tetB), sulfonamide (sul1 and sul2), chloramphenicol (catA1 and cmlA), quinolone (qnrA, qnrB, qnrD, qnrS, and qepA) and aminoglycoside (aac(6’)-Ib, aac(3)-II, and ant(2”)-I). Determination of the presence of virulence genes was carried out as previously described [31].
The antimicrobial resistance patterns of the CTX-resistant E. coli isolated from commercial layers are shown in Fig. 1. The rates of resistance to the various antimicrobials were as follows: nalidixic acid (80.0%), cephalothin (65.9%), ampicillin (54.1%), cefazolin (54.1%), ciprofloxacin (34.1%), gentamicin (34.1%), amoxicillin–clavulanate (30.6%), cefadroxil (25.9%), cefuroxime (25.9%), tetracycline (25.9%), trimethoprim–sulfamethoxazole (23.5%), chloramphenicol (17.6%), imipenem (11.8%), cefoxitin (10.6%), and cefepime (5.9%). Among the 85 CTX-resistant E. coli isolates, 28 (32.9%) isolates were identified as b-lactamase producers. Three extended-spectrum β-lactamase (ESBL) genes, blaCTX-M-1, blaCTX-M-14 and blaCTX-M-15, were identified in 1, 6, and 5 E. coli isolates, respectively. One pAmpC β-lactamase gene, blaCMY-2, was present in 4 E. coli. Additionally, a non-ESBL/pAmpC gene, blaTEM-1 was detected in 12 E. coli. Genotypic characteristics of the β-lactamase-producing E. coli are summarized in Table 2. Eighteen (64.3%) isolates were positive for aac(3)-II genes and 7 (25.0%) isolates carried the cmlA gene. The sul1 and sul2 genes were identified in 7 (25.0%) and 9 (32.1%) isolates, respectively, and there were 4 (14.3%) isolates that harbored both sul1 and sul2 genes. Likewise, 8 (28.6%) and 4 (14.3%) of the isolates contained tetA and tetB, respectively. Among these isolates, one (3.6%) detected both tetA and tetB. No isolates carried quinolone resistance genes (qnrA, qnrB, qnrD, qnrS, qepA and aac(6')-Ib-cr), chloramphenicol genes (catA1), or aminoglycoside resistance gene (aac(6’)-Ib and ant(2’’)-I). Six virulence genes (astA, eaeA, escV, fimH, iucC, and papC) were identified in 28 β-lactamase-producing E. coli and rates of occurrence of the virulence genes were as below: fimH (92.9%), iucC (25.0%), astA (21.4%), papC (10.7%), eaeA (7.1%) and escV (7.1%).
In this study, all CTX-resistant E. coli showed resistance to at least one antimicrobial. In particular, the rates of resistance to nalidixic acid, cephalothin, ampicillin, and cefazolin were more than 50.0%. Repeated and unsuitable use of antimicrobials has led to an increased rate of antimicrobial resistance [23]. Therefore, similar to the action in other countries, regulations on the use of antimicrobials in livestock is required in Korea [9].
The use of third-generation cephalosporins has led to the emergence of β-lactamase-producing-E. coli. In particular, the ESBL and pAmpC β-lactamase is one of the most important β-lactamase genes. In this study, 28 (32.9%) E. coli isolates were identified as b-lactamase producers. We detected four ESBL and pAmpC β-lactamase genes including three CTX-M genes (blaCTX-M-1, blaCTX-M-14 and blaCTX-M-15) and one pAmpC β-lactamase gene (blaCMY-2). These genes are some of the most common ESBL and pAmpC β-lactamase genes in E. coli isolates from poultry in many countries [13, 30]. Moreover, the blaTEM-1 gene was identified in 12 E. coli isolates. Although blaTEM-1 gene is not an ESBL and pAmpC β-lactamase, it is important to note that they can be induced into ESBL through mutations [1].
β-lactamase-producing bacteria are resistant to most β-lactams and can increase resistance to other antimicrobials [29]. Such effects threaten to narrow the potential uses of antimicrobials to treat infectious diseases [7]. In this study, 23 (82.1%) of the 28 β-lactamase-producing E. coli isolates harbored at least one antimicrobial resistant gene. The aac(3)-II gene, which has been related to aminoglycoside resistance, was the most often detected gene. According to the Korea Animal Health Products Association, gentamicin, which is one of the most widely used aminoglycosides, is steadily used in poultry in Korea [26]. Also, among the 28 β-lactamase-producing E. coli isolates, 25.0% and 32.1% harbored the sul1 and sul2 gene, respectively, and 28.6% and 14.3% carried the tetA and tetB gene, respectively. These genes have been reported among the Enterobacteriaceae in food animals. Moreover, despite the ban on the use of chloramphenicol for food animals in various countries, a chloramphenicol resistant gene (cmlA) was detected in 7 E. coli isolates, indicating that there is a reservoir of chloramphenicol resistance in bacteria from commercial layers.
Genetic determinants that may enhance the virulence of E. coli include a variety of virulence factors [16]. Such virulence factors can be transferred to other bacteria, posing a serious threat to public health through the food chain [19]. In this study, six virulence genes were found in commercial layers. In particular, fimH, iucC, and astA were the predominant virulence genes detected among the β-lactamase-producing E. coli isolates. These results agree with those in other recent studies that reported the observation of virulence genes in E. coli isolates from different sources [12]. The fimH and iucC genes contribute to the expression of virulence by promoting colonization in the gastrointestinal and urinary tracts of animals or human [11]. Moreover, the astA gene encodes a heat-stable enterotoxin in the enteroaggregative E. coli responsible for watery diarrhea [8]. The high prevalence of fimH, iucC, and astA in our study may indicate the potential virulence of E. coli in commercial layers in Korea. The results suggest that commercial layers are carrying various antimicrobial resistance and virulence genes. Our findings suggest that antimicrobials used in commercial layer facilities must be regulated in Korea, moreover, comprehensive surveillance is necessary to prevent the dissemination of antimicrobial resistant isolates.

ACKNOWLEDGMENTS

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Agriculture, Food and Rural Affairs Research Center Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (716002-7).

REFERENCES

1. Bajpai T, Pandey M, Varma M, Bhatambare GS. Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Med. 2017; 7:12–16.
[CrossRef] [Google Scholar]
2. Bradford PA. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev. 2001; 14:933–951.
[CrossRef] [Google Scholar]
3. Briñas L, Zarazaga M, Sáenz Y, Torres C, Brin L, Sa Y, Ruiz-larrea F. Escherichia coli Isolates from Foods, Humans, and Healthy Animals beta-Lactamases in Ampicillin-Resistant Escherichia coli Isolates from Foods, Humans, and Healthy Animals. Antimicrob Agents Chemother. 2002; 46:3156–3163.
[CrossRef] [Google Scholar]
4. Cavaco LM, Hasman H, Xia S, Aarestrup FM. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob Agents Chemother. 2009; 53:603–608.
[CrossRef] [Google Scholar]
5. Chauvin C, Le Devendec L, Jouy E, Le Cornec M, Francart S, Marois-Créhan C, Kempf I. National Prevalence of Resistance to Third-Generation Cephalosporins in Escherichia coli Isolates from Layer Flocks in France. Antimicrob Agents Chemother. 2013; 57:6351–6353.
[CrossRef] [Google Scholar]
6. CLSI. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. p. M100–S23. 2013.
7. Courvalin P. Antimicrobial drug resistance: ‘‘prediction is very difficult, especially about the future.’’. Emerg Infect Dis. 2005; 11:1503–1506.
[CrossRef] [Google Scholar]
8. Dulguer MV, Fabbricotti SH, Bando SY, Moreira-Filho CA, Fagundes-Neto U, Scaletsky IC. Atypical enteropathogenic Escherichia coli strains: phenotypic and genetic profiling reveals a strong association between enteroaggregative E. coli heat-stable enterotoxin and diarrhea. J Infect Dis. 2003; 188:1685–1694.
[CrossRef] [PDF] [Google Scholar]
9. Dutil L, Irwin R, Finley R, Ng LK, Avery B, Boerlin P, Bourgault AM, Cole L, Daignault D, Desruisseau A, Demczuk W, Hoang L, Horsman GB, Ismail J, Jamieson F, Maki A, Pacagnella A, Pillai DR. Ceftiofur resistance in Salmonella enterica serovar Heidelberg from chicken meat and humans, Canada. Emerg. Infect. Dis. 2010; 16:48–54.
[CrossRef] [Google Scholar]
10. Fleming A. On the antibacterial action of cultures of a penicillium, with special reference to their use in the isolation of B. influenzae. Br J Exp Pathol. 1929; 10:226–236.
[CrossRef] [PDF] [Google Scholar]
11. Flores-Meireles A, Walker J, Caparon M, Hultgren S. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nat Rev Microbiol. 2015; 13:269–284.
[CrossRef] [Google Scholar]
12. Gazal LE, Puño-Sarmiento JJ, Medeiros LP, Cyoia PS, da Silveira WD, Kobayashi RK, Nakazato G. Presence of pathogenicity islands and virulence genes of extraintestinal pathogenic Escherichia coli (ExPEC) in isolates from avian organic fertilizer. Poult Sci. 2015; 94:3025–3033.
[CrossRef] [Google Scholar]
13. Hiroi M, Yamazaki F, Harada T, Takahashi N, Iida N, Noda Y, Yagi M, Nishio T, Kanda T, Kawamori F, Sugiyama K, Masuda T, Hara-Kudo Y, Ohashi N. Prevalence of Extended-Spectrum β-Lactamase-Pro ducing Escherichia coli and Klebsiella pneumoniae in Food-Producing Animals. J Vet Med Sci. 2012; 74:189–195.
[CrossRef] [Google Scholar]
14. Hornish RE, Kotarski SF. Cephalosporins in veterinary medicine - ceftiofur use in food animals. Curr Top Med Chem. 2002; 2:717–231.
[CrossRef] [Google Scholar]
15. Jiang Y, Zhou Z, Qian Y, Wei Z, Yu Y, Hu S, Li L. Plasmid-mediated quinolone resistance determinants qnr and aac(6‘)-Ib-cr in extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in China. J Antimicrob Chemother. 2008; 61:1003–1006.
[CrossRef] [Google Scholar]
16. Johnson JR. Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev. 1991; 4:80–128.
[CrossRef] [Google Scholar]
17. Keane OM. Genetic diversity, the virulence gene profile and antimicrobial resistance of clinical mastitis-associated Escherichia coli. Res Microbiol. 2016; 167:678–684.
[CrossRef] [Google Scholar]
18. Kerrn MB, Klemmensen T, Frimodt-Møller N, Espersen F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J Antimicrob Chemother. 2002; 50:513–516.
[CrossRef] [Google Scholar]
19. Lambertini E, Karns JS, Van Kessel JA, Cao H, Schukken YH, Wolfgang DR, Smith JM, Pradhan AK. Dynamics of Escherichia coli Virulence Factors in Dairy Herds and Farm Environments in a Longitudinal Study in the United States. Appl Environ Microbiol. 2015; 81:4477–4488.
[CrossRef] [Google Scholar]
20. Maynard C, Fairbrother JM, Bekal S, Sanschagrin F, Levesque RC, Brousseau R, Masson L, Larivière S, Harel J. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob Agents Chemother. 2003; 47:3214–3221.
[CrossRef] [Google Scholar]
21. Minarini LAR, Poirel L, Cattoir V, Darini ALC, Nordmann P. Plasmid-mediated quinolone resistance determinants among enterobacterial isolates from outpatients in Brazil. J Antimicrob Chemother. 2008; 62:474–478.
[CrossRef] [Google Scholar]
22. Mohamed MA, Shehata MA, Rafeek E. Virulence Genes Content and Antimicrobial Resistance in Escherichia coli from Broiler Chickens. Vet Med Int. 2014; 2014:195189.
[Google Scholar]
23. Mooljuntee S, Chansiripornchai P, Chansiripornchai N. Prevalence of the cellular and molecular antimicrobial resistance against E. coli isolated from Thai broilers. Thai J Vet Med. 2010; 40:311–315.
[Google Scholar]
24. Pérez-Pérez FJ, Hanson ND. Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 2002; 40:2153–2162.
[CrossRef] [Google Scholar]
25. Pitout JDD, Hossain A, Hanson ND. Phenotypic and Molecular Detection of CTX-M-B-Lactamases Produced by Escherichia coli and Klebsiella spp. J Clin Microbiol. 2004; 42:5715–5721.
[CrossRef] [Google Scholar]
26. QIA; Animal and Plant Quarantine Agency. National antimicrobial resistance monitoring program. Gimcheon, Republic of Korea: 2017.
27. Sandvang D, Aarestrup FM. Characterization of aminoglycoside resistance genes and class 1 integrons in porcine and bovine gentamicin-resistant Escherichia coli. Microb Drug Resist. 2000; 6:19–27.
[CrossRef] [Google Scholar]
28. Sengeløv G, Agersø Y, Halling-Sørensen B, Baloda SB, Andersen JS, Jensen LB. Bacterial antibiotic resistance levels in Danish farmland as a result of treatment with pig manure slurry. Environ Int. 2003; 28:587–595.
[CrossRef] [Google Scholar]
29. Seo KW, Lee YJ. BPrevalence and characterization of β-lactamases genes and class 1 integrons in multi-drug resistant Escherichia coli isolates from chicken meat in Korea. 2018; 24:10.
[Google Scholar]
30. Smet A, Martel A, Persoons D, Dewulf J, Heyndrickx M, Catry B, Herman L, Haesebrouck F, Butaye P. Diversity of extended-spectrum β-lactamases and class C β-lactamases among cloacal Escherichia coli isolates in Belgian broiler farms. Antimicrob Agents Chemother. 2008; 52:1238–1243.
[CrossRef] [Google Scholar]
31. Tarchouna M, Ferjani A, Ben-Selma W, Boukadida J. Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection. Int J Infect Dis. 2013; 17:e450–e453.
[CrossRef] [Google Scholar]
32. Thakuria B, Lahon K. The Beta Lactam Antibiotics as an Empirical Therapy in a Developing Country: An Update on Their Current Status and Recommendations to Counter the Resistance against Them. J Clin Diagn Res. 2013; 7:1207–1214.
[CrossRef] [Google Scholar]
33. Van TTH, Chin J, Chapman T, Tran LT, Coloe PJ. Safety of raw meat and shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int J Food Microbiol. 2008; 124:217–223.
[CrossRef] [Google Scholar]
34. Wang M, Tran JH, Jacoby GA, Zhang Y, Wang F, Hooper DC. Plasmid‐mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob Agents Chemother. 2003; 47:2242–2248.
[CrossRef] [Google Scholar]

Fig. 1.
Antimicrobial resistance patterns of cefotaxime-resistant E. coli isolated from commercial layers in Korea. AM, ampicillin; AMC, amoxicillin-clavulanate; CZ, cefazolin; CF, cephalothin; CFR, cefadroxil; FOX, cefoxitin; CXM, cefuroxime; FEP, cefepime; TE, tetracycline; SXT, trimethoprim-sulfamethoxazole; NA, nalidixic acid; IPM, imipenem; CIP, ciprofloxacin; G, gentamicin; C, chloramphenicol.
jpvm-2019-43-1-31f1.tif
Table 1.
Primers for the detection of antimicrobial resistant genes used in this study
Antimicrobial Target Sequence (5’→3’) Size (bp) Reference
b-lactam CTX-M group I F: GACGATGTCACTGGCTGAGC 499 [25]
R: AGCCGCCGACGCTAATACA
CTX-M group II F: GCGACCTGGTTAACTACAATCC 351 [25]
R: CGGTAGTATTGCCCTTAAGCC
CTX-M group III F: CGCTTTGCCATGTGCAGCACC 307 [25]
R: GCTCAGTACGATCGAGCC
CTX-M group IV F: GCTGGAGAAAAGCAGCGGAG 474 [25]
R: GTAAGCTGACGCAACGTCTG
TEM F: TTCTTGAAGACGAAAGGGC 1,159 [3]
R: ACGCTCAGTGGAACGAAAAC
SHV F: CACTCAAGGATGTATTGTG 885 [3]
R: TTAGCGTTGCCAGTGCTCG
OXA F: TTCAAGCCAAAGGCACGATAG 814 [3]
R: TCCGAGTTGACTGCCGGGTTG
MOXM F: GCTGCTCAAGGAGCACAGGAT 520 [24]
R: CACATTGACATAGGTGTGGTGC
CITM F: TGGCCAGAACTGACAGGCAAA 462 [24]
R: TTTCTCCTGAACGTGGCTGGC
DHAM F: AACTTTCACAGGTGTGCTGGGT 405 [24]
R: CCGTACGCATACTGGCTTTGC
ACCM F: AACAGCCTCAGCAGCCGGTTA 346 [24]
R: TTCGCCGCAATCATCCCTAGC
EBCM F: TCGGTAAAGCCGATGTTGCGG 302 [24]
R: CTTCCACTGCGGCTGCCAGTT
FOXM F: AACATGGGGTATCAGGGAGATG 190 [24]
R: CAAAGCGCGTAACCGGATTGG
Tetracycline tetA F: GTAATTCTGAGCACTGTCGC 956 [28]
R: CTGCCTGGACAACATTGCTT
tetB F: CTCAGTATTCCAAGCCTTTG 414 [28]
R: ACTCCCCTGAGCTTGAGGGG
Sulfamethoxazole/trimet hoprim sul1 F: CTTCGATGAGAGCCGGCGGC 433 [18]
R: GCAAGGCGGAAACCCGCGCC
sul2 F: CGGCATCGTCAACATAACC 720 [20]
R: GTGTGCGGATGAAGTCAG
Chloramphenicol catA1 F: AGTTGCTCAATGTACCTATAACC 547 [33]
R: TTGTAATTCATTAAGCATTCTGCC
cmlA F: CCGCCACGGTGTTGTTGTTATC 698 [33]
R: CACCTTGCCTGCCCATCATTAG
Quinolone qnrA F: TCAGCAAGAGGATTTCTCA 627 [24]
R: GGCAGCACTATTACTCCCA
qnrB F: CGACCTGAGCGGCACTGAAT 515 [15]
R: TGAGCAACGATGCCTGGTAG
qnrD F: CGAGATCAATTTACGGGGAATA 582 [4]
R: AACAAGCTGAAGCGCCTG
qnrS F: ACCTTCACCGCTTGCACATT 571 [15]
R: CCAGTGCTTCGAGAATCAGT
qepA F: CGTGTTGCTGGAGTTCTTC 403 [21]
R: CTGCAGGTACTGCGTCATG
Aminoglycoside aac(6’)-Ib F: TGACCTTGCGATGCTCTATG 508 [15]
R: TTAGGCATCACTGCGTGTTC
aac(3)-II F: TGAAACGCTGACGGAGCCTC 369 [27]
R: GTCGAACAGGTAGCACTGAG
ant(2’’)-I F: GGGCGCGTCATGGAGGAGTT 369 [27]
R: TATCGCGACCTGAAAGCGGC
Table 2.
Antimicrobial resistance and virulence genes of 28 β-lactamase producing E. coli from commercial layer
β-lactamase gene Pattern of antimicrobial resistance1 Antimicrobial resistance genes
Virulence genes
Number
cmlA sul1 sul2 tetA tetB aac(3)-II astA eaeA escV fimH iucC papC
CTX-M-1 CZ, CF, CFR, CXM, CTX, CAZ, FEP, AM, AMC, TE, SXT, NA, CIP, G, C + - + - - + + - - + - - 1
CTX-M-14 CZ, CF, CFR, CXM, CTX, CAZ, AM, AMC, SXT, NA, IPM, G - - + - - - - - - + - - 2
CZ, CF, CFR, CXM, CTX, AM, AMC, SXT, NA, IPM, G - - + - - - - - - - - - 1
CZ, CF, CFR, CXM, CTX, AM, SXT, NA, G - - + - - - - - - + - - 1
CZ, CF, CFR, CXM, CTX, FEP, AM, SXT, G - + + - - - - - - + + - 1
CZ, CF, CFR, CXM, CTX, AM, G - - - - - + - - - + - - 1
CTX-M-15 CZ, CF, CFR, CXM, CTX, AM, AMC, NA, IPM, G - - - - - + - - - + - - 1
CZ, CF, CFR, CXM, CTX, CAZ, FEP, AM, AMC, SXT, G, C - + + - - - + - - + - - 1
CZ, CF, CFR, CXM, CTX, AM, AMC, TE, SXT, NA, G, C + + - + + - + - - + - - 1
CZ, CF, CFR, FOX, CXM, CTX, CAZ, FEP, AM, NA, G - - - - - - - - - + - - 1
CZ, CF, CFR, CXM, CTX, CAZ, FEP, AM, NA, G - - - - - + - - - + - - 1
CMY-2 CZ, CF, CFR, FOX, CXM, CTX, CAZ, AM, AMC, NA, IPM, CIP, G - - - - - + - - - + - - 2
CZ, CF, CFR, FOX, CXM, CTX, CAZ, AM, AMC, NA - - - - - - - - - + - - 1
CZ, CF, CFR, FOX, CXM, CTX, CAZ, AM, AMC - - - - - - - - - + - - 1
TEM-1 CZ, CF, CTX, CAZ, AM, TE, SXT, NA, CIP, G, C + + - + - + + - - + - - 1
CZ, CF, CTX, AM, AMC, TE, SXT, NA, IPM, G, C + + - + - + + - - + - - 1
CZ, CF, CTX, CAZ, AM, AMC, TE, NA, CIP, G - - - - + + - - - + + + 1
CZ, CTX, CAZ, AM, TE, SXT, NA, CIP, G - - + + - - - + + + + - 1
CZ, CF, CTX, CAZ, AM, TE, SXT, NA, C + - + + + - + - - + - - 1
CZ, CF, CTX, CAZ, AM, AMC, TE, NA, CIP - - - - + - - - - + + + 1
CZ, CF, CTX, AM, TE, SXT, NA, CIP, C - + + + - - - + + + + - 1
CZ, CF, CTX, CAZ, AM, SXT, NA, CIP - + + - - - - - - - - - 1
CZ, CF, CFR, CXM, CTX, AM, AMC, NA - - - - - - - - - + - - 1
CZ, CF, CTX, CAZ, AM, AMC, NA, G - - - - - + - - - + + - 1
CZ, CF, CTX, CAZ, AM, AMC, NA - - - - - - - - - + - - 1
CZ, CTX, CAZ, AM, NA, G - - - - - + - - - + + + 1

1 CZ, cefazolin; CF, cephalothin; CFR, cefadroxil; CXM, cefuroxime; FOX, cefoxitin; CTX, cefotaxime; CAZ, ceftazidime; EFT, ceftiofur, AM, ampicillin; AMC, amoxicillin-clavulanate; TE, tetracycline; SXT, sulfamethoxazole/trimethoprim; NA, nalidixic acid; IPM, imipenem; CIP, ciprofloxacin, G, gentamicin; C, chloramphenicol.

Formats:
Article | 
PDF LinksPDF(531K) | PubReaderPubReader | EpubePub | 
Download Citation
Share  |
         
METRICS
321
View
1
Save
0
Cited-By
In This Page: