Noh and Son: Effect of spirulina on corneal epithelial wound healing in zebrafish

Abstract

This study investigated the regenerative and healing effect of spirulina on corneal epithelial injury by acid burn in zebrafish. Corneal epithelium of adult zebrafish was evaluated at 0, 12, 24, 48 h after acid burn injury with or without immersion with 0.02 and 0.04 mg/mL of spirulina water extract. The pathological changes of corneal epithelium were assessed by light microscopy. Gene and protein expressions of proliferating cell nuclear antigen (PCNA), matrix metalloproteinase (MMP) 9 and MMP13 were determined by immunohistochemistry or real-time PCR. Corneal epithelium was denuded totally after acid burn and gradually regenerated. PCNA-positive cells significantly increased in spirulina treated group. MMP9 and MMP13 mRNA transcripts were significantly decreased in spirulina treated groups. In conclusion, spirulina has regenerative and healing properties by increased keratocyte proliferation, and inhibited extracellular matrix degradation during the regeneration process of corneal epithelial injury by acid burn in zebrafish.

Introduction

Due to its small size and ease of raise, zebrafish becomes novel model for various researches. Recently, zebrafish have also been used to establish model for cutaneous wound healing. Cutaneous wounds are re-epithelialized extremely, rapidly and independently of blood clot formation and inflammation in zebrafish [19].
The corneal epithelium locates the outermost surface of the cornea. Corneal epithelial injury may result from mechanical trauma, chemical burns or infections [12]. After corneal epithelial injury, healing response initiates very quickly depending on stimulation of various cytokines and growth factors [2]. Proliferating cell nuclear antigen (PCNA) is a cell cycle regulatory protein that is naturally expressed in proliferating cells and an index of cell turnover or cell proliferation [21]. Matrix metalloproteinases (MMPs) are a group of zinc-binding proteolytic enzymes that participate in degrading and remodeling of the extracellular matrix (ECM) in physiological and pathologic conditions [10].
Several agents may enhance the wound healing process [9, 12, 15, 18]. Spirulina, a spiral coil shaped blue-green algae is a valuable food source of nutrient including high quality protein, lipid and carbohydrates, as well as elements such as carotenoids, vitamins and minerals, C-phycocyanin (CPC) etc. [14]. The extracts of spirulina are known to possess beneficial effects including anticancer, antiviral and hepatoprotective effects [5, 7, 13]. They also stimulated wound healing activities both in vitro and in vivo [6].
This study investigated pathological features of corneal epithelium after acid burn, and wound healing effect of spirulina in zebrafish. Healing processes of corneal epithelium was evaluated histopathologically, as well as by detecting expression of proliferating cell nuclear antigen (PCNA), matrix metalloproteinase (MMP) 9 and MMP13 by immunohistochemistry or real-time PCR analysis.

Materials and Methods

Preparation of spirulina

Spirulina was kindly supplied by Dr. Kang (Korea Institute of Ocean Science and Technology, Jeju Special Self-Governing Province, Rep. of Korea). Spirulina extract was prepared by maceration of 5 g of spirulina powder in 500 ml of distilled water for 24 h at room temperature. The mixture was then centrifuged at 3,000 rpm for 10 min (4 °C) and the supernatant was filtered with 0.2 μm syringe filter (Advantec, CA, USA) to remove debris. All materials were stored at ?20 °C until further experiments.

Maintenance of zebrafish

Wild type adult zebrafish (Danio rerio) were reared under laboratory conditions of 14 h light: 10 h dark at 28 °C with standard culture conditions (dissolved oxygen > 6 mg/L, un-ionized ammonia < 0.02 mg/L, conductivity range 500?600 μS, nitrate < 30 mg/L, nitrite < 0.01 mg/mL, salinity 0.6 g/L, and neutral pH). All experiments with zebrafish were conducted in accordance with the guidelines and regulations of the Animal Ethics Committee of Chungnam National University.

Experimental design

3-5 cm long adult zebrafish (n=50) were divided into 5 groups. Under anesthesia, about 5 μl volume of 3% acetic acid (Sigma, MO, USA) was applied to the central cornea of right eye with a sterile cotton swab. After a 5 sec exposure, the acid was rapidly washed by irrigation with physiological saline. Fish were immersed for 0, 12, 24, 48 h after injury in static water baths containing 0.02 and 0.04 mg/mL of spirulina in a total volume of 500 ml. Static water baths with normal water performed as negative control and static water bath with 0.03 mg/mL of beta glucan from barley (Sigma, MO, USA) performed as positive control. Fish were observed for signs of abnormalities and mortalities. Fish were euthanized with an overdose of Tricaine at designated time points and all eyes were necropsied.

Histopathological examination

For light microscopic evaluation, eyes were fixed in Davidson's fixative solution and routinely processed, embedded in paraffin wax. Using microtome (Microm, WA, Germany), 4 μm-thick sections were made at the level of the central cornea. Corneal sections were stained with hematoxylin?eosin (H&E). Five sections for each cornea were used to evaluate the histopathological examination.
H&E stained sections were all imaged and central corneal thickness was measured. The thickness of central cornea epithelium was calculated by measuring the distance between the surface and bottom of the epithelial layer. Measurement was made with Cellsense standard imaging software (Olympus, Tokyo, Japan) under 400x magnification.
Immunohistochemistry (IHC) was performed using monoclonal antibodies specific for proliferating cell nuclear antigen (PCNA). In brief, after deparaffinization, antigen retrieval was performed in a 100 w microwave for 10 minutes. After endogenous peroxidase was quenched, the tissue sections were blocked with normal goat serum and then incubated 1 h at room temperature with 1:200-diluted anti-PCNA rabbit monoclonal antibody (Abcam, MA, USA). After washing, goat anti-rabbit-biotinylated antibody (Vector Laboratories, CA, USA) was applied for 1 h at room temperature. Biotin/avidin method was used to label the sections with ABC kit (Vector Laboratories, CA, USA) and DAB peroxidase substrate kit (Vector Laboratories, CA, USA) was used for detection. Sections were counterstained with hematoxylin. The number of total epithelial cells and immunopositive cells was counted in a 50 μm square box image on the central part of cornea under 400x magnification.
Total RNA was extracted with TRIzol reagent (Ambion, Tokyo, Japan) according to the manufacturer's protocol. cDNA was synthesized using ReverTra Ace® qPCR RT Kit (Toyobo, Osaka, Japan), following the manufacturer's instructions. Quantitative real-time PCR was performed by using iQ SYBR Green Supermix on StepOnePlus Real-Time PCR System (Biosystems-Life tech, CA, USA). The primer sets used were designed as shown in Table 1. The mRNA level was normalized by housekeeping gene β-actin.
Table 1.
Description of primers used in this study
Gene TM(°C) Primer name Primer sequence (5’-3’)
Matrix metalloproteinase 9 (MMP9) 56 MMP-9-F
MMP-9-R
TTTGCCCTGATCGTGGATAC
GGGAAACCCTCCACGTATTT
Matrix metalloproteinase 13 (MMP13) 56 MMP-13-F
MMP-13-R
GAGAAGGTTTGGGCTCTCTATG
TGAGTTGCTGTCTTCCTTGTAG

Statistical analysis

The statistical analysis was performed with commercial software (SPSS for Windows, ver.23.0; SPSS Sciences, IL, USA). Data were expressed as mean ± SEM and analyzed using ANOVA with the least-significant difference (LSD) or Dunnett T3 post hoc test for group-group comparison. The result of p <0.05 was considered to be statistically significant.

Results

Histopathological examination

Immediately after acid burn induction, the total loss of epithelial layers was observed (Fig. 1). In normal cornea, average of corneal epithelium thickness was about 13.95±2.04 μm. In spirulina treated group, the regenerated epithelium was thicker compared to controls at 12, 24, and 48 hours post injury (hpi). At 48 hpi, the epithelium of 0.04 mg/mL spirulina treated group was significantly thicker than that of normal water treated group (Fig. 2).
Fig. 1.
Histopathology of cornea in adult zebrafish. (A) Normal, (B) Cornea immediately after 3% acetic acid burn. H&E stain, (C) Immunohistochemical stain of central cornea with PCNA. 12 h after 3% acetic acid burn in zebrafish. The arrows show some of the PCNA positive cells. Bar=10μm.
jpvm-2020-44-4-222f1.gif
Fig. 2.
Corneal epithelium thickness after acid burn injury on central cornea of zebrafish. The thickness of central cornea epithelium was calculated by measuring the distance between the surface and the bottom of epithelial layer. ∗, P< 0.05 vs. Injury+Normal water; #, P< 0.05 vs. Uninjured normal control.
jpvm-2020-44-4-222f2.gif

Immunohistochemistry

Cell proliferative activity was evaluated by PCNA. In 12 hpi and 24 hpi, both negative control and spirulina treated group, high number of regenerated epithelial cells was positive for PCNA. Lower level of PCNA expression was detected at 48 hpi than at 24 hpi. At 12 hpi, the number of PCNA-positive cells in 0.04 mg/mL spirulina treated group was relatively higher than that of the negative control group at the P=0.069 level (Fig. 3).
Fig. 3.
Percentages of PCNA-positive cells in central corneal region after acid burn injury of zebrafish. 50 μm square boxes on the immunostained image were used for analysis. Total positive cells were counted in a box and divided that number by total number of epithelial cells in the same region.
jpvm-2020-44-4-222f3.gif

Real-time RT-PCR

Real-time RT-PCR showed that levels of MMP9 and MMP13 mRNA transcript were significantly lower in the 0.04 mg/mL spirulina group than that of the negative control group at 48 hpi (Figs. 4, 5).
Fig. 4.
Quantitative real-time RT-PCR analysis of MMP9 mRNA expression levels in the cornea of zebrafish at 24 and 48 hpi. The values were relative to those of the housekeeping gene (β-actin), with values representing the fold change relative to that of normal control group. Significance values are given as: ∗, P< 0.05 vs. Injury+Normal water; #, P< 0.05 vs. Uninjured normal control.
jpvm-2020-44-4-222f4.gif
Fig. 5.
Quantitative real-time RT-PCR analysis of MMP13 mRNA expression levels in the cornea of zebrafish at 24 and 48 hpi. The values were relative to those of the housekeeping gene (β-actin), with values representing the fold change relative to that of normal control group. Significance values are given as: ∗, P< 0.05 vs. Injury+Normal water; #, P< 0.05 vs. Uninjured normal control.
jpvm-2020-44-4-222f5.gif

Discussion

Zebrafish are increasingly used in research as an alternative to mammalian species. The characteristics such as genetic similarity to humans, low cost, rapid cell migration making zebrafish a valuable model for studying wound repair [19]. Zebrafish cornea contains all five major layers found in the human cornea: the epithelium, Bowman's layer, stroma, Descemet's membrane, and endothelium. The epithelium, located anteriorly, consists of four to six layers of nonkeratinized, stratified squamous cells [25]. As the epithelium locates the outermost surface of the cornea, corneal epithelium is most likely to be damaged by traumas, chemicals and infections [3]. The recovery of epithelium is critical to maintaining corneal transparency. Fortunately, the epithelial layer heals quickly and effectively, along with rapid returns toward structural and functional integrity [16]. In this study, we confirmed the possibilities of zebrafish as a corneal epithelial wound healing model by histopathologic evaluation and gene expression. The results of this study support previous findings that zebrafish can be an efficient model for corneal injury and regeneration [23, 25]. But environmental differences between air and water should be considered and various studies are needed to adjust the data of zebrafish to human cornea. In spite of many similarities between zebrafish and human cornea, structure of zebrafish cornea has significant differences. For example, zebrafish cornea is considerably thinner than human cornea and the contribution of the stroma to corneal thickness is significantly lower than human cornea [25]. The difference in corneal epithelial thickness might arise due to adaptation to environmental conditions. In a study about adaptive differences of the air and water corneas of the “four-eyed” fish (Anableps anableps), dorsal cornea has thicker epithelium, which expose directly to the sunlight [22]. In human, more layers of corneal epithelial cells may provide additional chromophores to absorb UV light. Moreover, conspicuously low levels of total protein in zebrafish cornea can make less variation of level changes in specific proteins [25].
Several therapies are used for promote tissue repair. Many plant-based products have been known to possess therapeutic effects of wound healing [15,18]. Spirulina is rich in proteins, carotenoids and other micronutrients. Bioactive components of spirulina have been reported to have wound healing, anti-inflammatory, antioxidants and anti-microbial effects [1, 7, 13, 17, 20]. C-phycocyanin isolated from crude spirulina extract are reported to have wound healing activities through increase cell proliferation and growth stimulation [6]. Topical application of polysaccharide extract from Spirulina platensis significantly inhibited corneal neovascularization caused by alkali burn in the mouse model [23]. Moreover, spirulina has been used as food supplements for fish, incorporation of spirulina in the diets of fish improved the health conditions of fish through tissue protection and anti-oxidant effects [8]. In the present study, zebrafish corneal epithelium was totally denuded after acid burn and gradually regenerated during the study. Spirulina increased corneal epithelial thickness and PCNA-positive cells, and decreased MMP9 and MMP13 levels. PCNA, a marker for cell proliferation, is expressed in regenerated corneal epithelial cells. After photorefractive keratectomy in rabbit cornea, PCNA expression was first seen 24 h after injury and the expression was then spread throughout the covering epithelium. By 48 h after injury PCNA expression was seen over the whole regenerated epithelium [4]. In zebrafish, positively expressed cells for PCNA were increased as epithelial regeneration after injury, as it seen in other animals [24]. In our study, PCNA expression was increased until 24 hpi in zebrafish. Spirulina treated epithelium showed higher intensity of PCNA expression than control group during regenerating processes, had a moderate trend toward significance compared to negative control group. In addition, spirulina significantly reduced MMP9 and MMP13 expressions at 48 hpi. MMPs are believed to be involved in matrix degradation, neovascularization and inflammation. And persistent expression of MMPs causes delayed corneal wound healing. It is considered spirulina contributed to smooth regeneration of corneal epithelium through downregulation of MMPs [9]. However, more mechanistic studies are required to validate and quantify the effect of spirulina on regeneration and healing of corneal epithelium in zebrafish.

Acknowledgements

This work was supported by Chungnam national university.

Conflict of Interest

We declare that we have no conflict of interest.

References

1.Abed RM., Dobretsov S., Sudesh K. Applications of cyanobacteria in biotechnology. J Appl Microbiol. 2009. 106(1):1–12.
[CrossRef] [Google Scholar]
2.Barrientos S., Stojadinovic O., Golinko MS., Brem H., Tomic-Canic M. Growth factors and cytokines in wound healing. Wound Repair Regen. 2008. 16(5):585–601.
[CrossRef] [Google Scholar]
3.Cecchetti DF., Cecchetti SA., Nardy AC., Carvalho SC., Rodrigues MD., Rocha EM. A clinical and epidemiological profile of ocular emergences in a reference emergency center. Arq Bras Oftalmol. 2008. 71(5):635–638.
[CrossRef] [Google Scholar]
4.Gan L., Hamberg-Nystrom H., Fagerholm P., Van Setten G. Cellular proliferation and leukocyte infiltration in the rabbit cornea after photorefractive keratectomy. Acta Ophthalmol Scand. 2001. 79(5):488–492.
[CrossRef] [Google Scholar]
5.Gonzalez de Rivera C., Miranda-Zamora R., Diaz-Zagoya JC., Juarez-Oropeza MA. Preventive effect of Spirulina maxima on the fatty liver induced by a fructose-rich diet in the rat, a preliminary report. Life Sci. 1992. 53(1):57–61.
[Google Scholar]
6.Gur CS., Erdogan DK., Onbasilar I., Atilla P., Cakar N., Gurhan ID. In vitro and in vivo investigations of the wound healing effect of crude Spirulina extract and C-phycocyanin. J Med Plant Res. 2013. 7(8):425–433.
[Google Scholar]
7.Hayashi K., Hayashi T., Kojima I. A natural sulfated polysaccharide, calcium spirulan, isolated from Spirulina platensis: in vitro and ex vivo evaluation of anti-herpes simplex virus and anti-human immunodeficiency virus activities. AIDS Res Hum Retroviruses. 1996. 12(15):1463–1471.
[CrossRef] [Google Scholar]
8.Ibrahem MD., Ibrahim MA. The potential effects of Spirulina platensis (Arthrospira platensis) on tissue protection of Nile tilapia (Oreochromis niloticus) through estimation of p53 level. J Adv Res. 2014. 5(1):133–136.
[CrossRef] [Google Scholar]
9.Kim EC., Kim TK., Park SH., Kim MS. The wound healing effects of vitamin A eye drops after a corneal alkali burn in rats. Acta Ophthalmol. 2012. 90(7):540–546.
[CrossRef] [Google Scholar]
10.Loffek S., Schilling O., Franzke CW. Biological role of matrix metalloproteinases: a critical balance. Eur Respir J. 2011. 38(1):191–208.
[CrossRef] [Google Scholar]
11.Ljubimov AV., Saghizadeh M. Progress in corneal wound healing. Prog Retin Eye Res. 2015. 49:17–45.
[CrossRef] [Google Scholar]
12.Martin LFT., Rocha EM., Garcia SB., Garcia JS. Topical Brazilian propolis improves corneal wound healing and inflammation in rats following alkali burns. BMC complement Altern med. 2013. 13(1):1–7.
[CrossRef] [Google Scholar]
13.Mathew B., Sankaranarayanan R., Nair PP., Varghese C., Somanathan T., Amma BP., Amma NS., Nair MK. Evaluation of chemoprevention of oral cancer with Spirulina fusiformis. Nutr Cancer. 1995. 24(2):197–202.
[CrossRef] [Google Scholar]
14.Mazo VK., Gmoshinsk? IV., Zilova IS. Microalgae Spirulina in human nutrition. Vopr Pitan. 2004. 73(1):45–53.
[Google Scholar]
15.Paiva LA., de Alencar Cunha KM., Santos FA., Gramosa NV., Silveira ER., Rao VS. Investigation on the wound healing activity of oleo-resin from Copaifera langsdorffi in rats. Phytother Res. 2002. 16(8):737–739.
[CrossRef] [Google Scholar]
16.Pfister RR., Burstein N. The alkali burned cornea I. Epithelial and stromal repair. Exp Eye Res. 1976. 23(5):519–535.
[Google Scholar]
17.Plaza M., Herrero M., Cifuentes A., Ibanez E. Innovative natural functional ingredients from microalgae. J Agric Food Chem. 2009. 57(16):7159–7170.
[CrossRef] [Google Scholar]
18.Priya KS., Arumugam G., Rathinam B., Wells A., Babu M. Celosia argentea Linn, leaf extract improves wound healing in a rat burn wound model. Wound Repair Regen. 2004. 12(6):618–625.
[CrossRef] [Google Scholar]
19.Richardson R., Slanchev K., Kraus C., Knyphausen P., Eming S., Hammerschmidt M. Adult zebrafish as a model system for cutaneous wound-healing research. J Invest Dermatol. 2013. 133(6):1655–1665.
[CrossRef] [Google Scholar]
20.Singh S., Kate BN., Banerjee UC. Bioactive compounds from cyanobacteria and microalgae: an overview. Crit Rev Biotechnol. 2005. 25(3):73–95.
[CrossRef] [Google Scholar]
21.Strzalka W., Ziemienowicz A. Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation. Ann Bot. 2011. 107(7):1127–1140.
[CrossRef] [Google Scholar]
22.Swamynathan SK., Crawford MA., Robison WG Jr., Kanungo J., Piatigorsky J. Adaptive differences in the structure and macromolecular compositions of the air and water corneas of the “four-eyed” fish (Anableps anableps). FASEB J. 2003. 17(14):1996–2005.
[CrossRef] [Google Scholar]
23.Yang L., Wang Y., Zhou Q., Chen P., Wang Y., Wang Y., Liu T., Xie L. Inhibitory effects of polysaccharide extract from Spirulina piatensis on corneal neovascularization. Mol Vis. 2009. 15:1951–1961.
[Google Scholar]
24.Yew DT., Lam TK., Tsang D., Au YK., Li WW., Tso MO. Changes of cytochemical markers in the conjunctival and corneal epithelium after corneal debridement. Cell Mol Neurobiol. 2000. 20(4):465–482.
[CrossRef] [Google Scholar]
25.Zhao XC., Yee RW., Norcom E., Burgess H., Avanesov AS., Barrish JP., Malicki J. The zebrafish cornea: structure and development. Invest Ophthalmo Vis Sci. 2006. 47(10):4341–4348.
[CrossRef] [Google Scholar]

Formats

PDF LinksPDF(938K)EpubePubPubReaderPubReader
Download Citation
METRICS Graph View

725

View

1

Save

0

Cited-By